prism statistical software package for windows, version 6.0 Search Results


reference strain bacillus cereus atcc 14579  (ATCC)
99
ATCC reference strain bacillus cereus atcc 14579
Expression profiles of inhA1, nprA, and hlyII among B. cereus strains. Logarithmic representation of the expression levels of inhA1, nprA, and hlyII among 57 (54 for inhA1) B. cereus nonpathogenic (NP), food-poisoning (FP), and clinical (C) strains normalized to the mean expression value of the two reference genes rpoA and rpoB. For each strain, the mean value of two independent experiments done in duplicate is represented as a cross. For each pathogenic profile, the mean value is represented as a dot and the median value as a bold line. The × symbol represents the nprA expression level of the NVH 0391/98 strain.
Reference Strain Bacillus Cereus Atcc 14579, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prism+statistical+software+package+for+windows%2C+version+6%2E0/pmc02849619-161-212-216?v=ATCC
Average 99 stars, based on 1 article reviews
reference strain bacillus cereus atcc 14579 - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier
silicon nitride windows  (Norcada Inc)
95
Norcada Inc silicon nitride windows
Expression profiles of inhA1, nprA, and hlyII among B. cereus strains. Logarithmic representation of the expression levels of inhA1, nprA, and hlyII among 57 (54 for inhA1) B. cereus nonpathogenic (NP), food-poisoning (FP), and clinical (C) strains normalized to the mean expression value of the two reference genes rpoA and rpoB. For each strain, the mean value of two independent experiments done in duplicate is represented as a cross. For each pathogenic profile, the mean value is represented as a dot and the median value as a bold line. The × symbol represents the nprA expression level of the NVH 0391/98 strain.
Silicon Nitride Windows, supplied by Norcada Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prism+statistical+software+package+for+windows%2C+version+6%2E0/pm33938047-157-18-21?v=Norcada+Inc
Average 95 stars, based on 1 article reviews
silicon nitride windows - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier
6 0 for windows  (STATA Corporation)
99
STATA Corporation 6 0 for windows
Expression profiles of inhA1, nprA, and hlyII among B. cereus strains. Logarithmic representation of the expression levels of inhA1, nprA, and hlyII among 57 (54 for inhA1) B. cereus nonpathogenic (NP), food-poisoning (FP), and clinical (C) strains normalized to the mean expression value of the two reference genes rpoA and rpoB. For each strain, the mean value of two independent experiments done in duplicate is represented as a cross. For each pathogenic profile, the mean value is represented as a dot and the median value as a bold line. The × symbol represents the nprA expression level of the NVH 0391/98 strain.
6 0 For Windows, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prism+statistical+software+package+for+windows%2C+version+6%2E0/pm15482583-64-10-9?v=STATA+Corporation
Average 99 stars, based on 1 article reviews
6 0 for windows - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier
rapid kv switching ct kvsct-canon  (Canon inc)
90
Canon inc rapid kv switching ct kvsct-canon
Expression profiles of inhA1, nprA, and hlyII among B. cereus strains. Logarithmic representation of the expression levels of inhA1, nprA, and hlyII among 57 (54 for inhA1) B. cereus nonpathogenic (NP), food-poisoning (FP), and clinical (C) strains normalized to the mean expression value of the two reference genes rpoA and rpoB. For each strain, the mean value of two independent experiments done in duplicate is represented as a cross. For each pathogenic profile, the mean value is represented as a dot and the median value as a bold line. The × symbol represents the nprA expression level of the NVH 0391/98 strain.
Rapid Kv Switching Ct Kvsct Canon, supplied by Canon inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prism+statistical+software+package+for+windows%2C+version+6%2E0/pmc08739122-231-237-239?v=Canon+inc
Average 90 stars, based on 1 article reviews
rapid kv switching ct kvsct-canon - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
prism version 6.0 for windows  (GraphPad Software Inc)
90
GraphPad Software Inc prism version 6.0 for windows
Expression profiles of inhA1, nprA, and hlyII among B. cereus strains. Logarithmic representation of the expression levels of inhA1, nprA, and hlyII among 57 (54 for inhA1) B. cereus nonpathogenic (NP), food-poisoning (FP), and clinical (C) strains normalized to the mean expression value of the two reference genes rpoA and rpoB. For each strain, the mean value of two independent experiments done in duplicate is represented as a cross. For each pathogenic profile, the mean value is represented as a dot and the median value as a bold line. The × symbol represents the nprA expression level of the NVH 0391/98 strain.
Prism Version 6.0 For Windows, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prism+statistical+software+package+for+windows%2C+version+6%2E0/10__1530_slash_joe___15___0467-139-10-11?v=GraphPad+Software+Inc
Average 90 stars, based on 1 article reviews
prism version 6.0 for windows - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
prism 6.0 for windows  (GraphPad Software Inc)
90
GraphPad Software Inc prism 6.0 for windows
Expression profiles of inhA1, nprA, and hlyII among B. cereus strains. Logarithmic representation of the expression levels of inhA1, nprA, and hlyII among 57 (54 for inhA1) B. cereus nonpathogenic (NP), food-poisoning (FP), and clinical (C) strains normalized to the mean expression value of the two reference genes rpoA and rpoB. For each strain, the mean value of two independent experiments done in duplicate is represented as a cross. For each pathogenic profile, the mean value is represented as a dot and the median value as a bold line. The × symbol represents the nprA expression level of the NVH 0391/98 strain.
Prism 6.0 For Windows, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prism+statistical+software+package+for+windows%2C+version+6%2E0/10__1530_slash_erc___15___0092-122-5-6?v=GraphPad+Software+Inc
Average 90 stars, based on 1 article reviews
prism 6.0 for windows - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
r studio software version 1.0.136  (RStudio)
90
RStudio r studio software version 1.0.136
Expression profiles of inhA1, nprA, and hlyII among B. cereus strains. Logarithmic representation of the expression levels of inhA1, nprA, and hlyII among 57 (54 for inhA1) B. cereus nonpathogenic (NP), food-poisoning (FP), and clinical (C) strains normalized to the mean expression value of the two reference genes rpoA and rpoB. For each strain, the mean value of two independent experiments done in duplicate is represented as a cross. For each pathogenic profile, the mean value is represented as a dot and the median value as a bold line. The × symbol represents the nprA expression level of the NVH 0391/98 strain.
R Studio Software Version 1.0.136, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prism+statistical+software+package+for+windows%2C+version+6%2E0/pmc07226673-120-17-5?v=RStudio
Average 90 stars, based on 1 article reviews
r studio software version 1.0.136 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
temporary glass window merk rectangular cover glass  (Merck KGaA)
90
Merck KGaA temporary glass window merk rectangular cover glass
Expression profiles of inhA1, nprA, and hlyII among B. cereus strains. Logarithmic representation of the expression levels of inhA1, nprA, and hlyII among 57 (54 for inhA1) B. cereus nonpathogenic (NP), food-poisoning (FP), and clinical (C) strains normalized to the mean expression value of the two reference genes rpoA and rpoB. For each strain, the mean value of two independent experiments done in duplicate is represented as a cross. For each pathogenic profile, the mean value is represented as a dot and the median value as a bold line. The × symbol represents the nprA expression level of the NVH 0391/98 strain.
Temporary Glass Window Merk Rectangular Cover Glass, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prism+statistical+software+package+for+windows%2C+version+6%2E0/10__7554_slash_elife__77440-460-3-6?v=Merck+KGaA
Average 90 stars, based on 1 article reviews
temporary glass window merk rectangular cover glass - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
software windows  (TIBCO)
90
TIBCO software windows
Expression profiles of inhA1, nprA, and hlyII among B. cereus strains. Logarithmic representation of the expression levels of inhA1, nprA, and hlyII among 57 (54 for inhA1) B. cereus nonpathogenic (NP), food-poisoning (FP), and clinical (C) strains normalized to the mean expression value of the two reference genes rpoA and rpoB. For each strain, the mean value of two independent experiments done in duplicate is represented as a cross. For each pathogenic profile, the mean value is represented as a dot and the median value as a bold line. The × symbol represents the nprA expression level of the NVH 0391/98 strain.
Software Windows, supplied by TIBCO, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prism+statistical+software+package+for+windows%2C+version+6%2E0/pmc07976968-353-2-6?v=TIBCO
Average 90 stars, based on 1 article reviews
software windows - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
4f4t-neurop  (NeurOp Inc)
90
NeurOp Inc 4f4t-neurop
Expression profiles of inhA1, nprA, and hlyII among B. cereus strains. Logarithmic representation of the expression levels of inhA1, nprA, and hlyII among 57 (54 for inhA1) B. cereus nonpathogenic (NP), food-poisoning (FP), and clinical (C) strains normalized to the mean expression value of the two reference genes rpoA and rpoB. For each strain, the mean value of two independent experiments done in duplicate is represented as a cross. For each pathogenic profile, the mean value is represented as a dot and the median value as a bold line. The × symbol represents the nprA expression level of the NVH 0391/98 strain.
4f4t Neurop, supplied by NeurOp Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prism+statistical+software+package+for+windows%2C+version+6%2E0/pm27932075-140-12-1?v=NeurOp+Inc
Average 90 stars, based on 1 article reviews
4f4t-neurop - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
ddr4 2133 mhz 256 gb ram  (Hynix Semiconductor Manufacturing America Inc)
90
Hynix Semiconductor Manufacturing America Inc ddr4 2133 mhz 256 gb ram
Expression profiles of inhA1, nprA, and hlyII among B. cereus strains. Logarithmic representation of the expression levels of inhA1, nprA, and hlyII among 57 (54 for inhA1) B. cereus nonpathogenic (NP), food-poisoning (FP), and clinical (C) strains normalized to the mean expression value of the two reference genes rpoA and rpoB. For each strain, the mean value of two independent experiments done in duplicate is represented as a cross. For each pathogenic profile, the mean value is represented as a dot and the median value as a bold line. The × symbol represents the nprA expression level of the NVH 0391/98 strain.
Ddr4 2133 Mhz 256 Gb Ram, supplied by Hynix Semiconductor Manufacturing America Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prism+statistical+software+package+for+windows%2C+version+6%2E0/pmc05191002-307-8-25?v=Hynix+Semiconductor+Manufacturing+America+Inc
Average 90 stars, based on 1 article reviews
ddr4 2133 mhz 256 gb ram - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier
adware/popup window blocking tool  (AdWare Research Ltd)
90
AdWare Research Ltd adware/popup window blocking tool
Expression profiles of inhA1, nprA, and hlyII among B. cereus strains. Logarithmic representation of the expression levels of inhA1, nprA, and hlyII among 57 (54 for inhA1) B. cereus nonpathogenic (NP), food-poisoning (FP), and clinical (C) strains normalized to the mean expression value of the two reference genes rpoA and rpoB. For each strain, the mean value of two independent experiments done in duplicate is represented as a cross. For each pathogenic profile, the mean value is represented as a dot and the median value as a bold line. The × symbol represents the nprA expression level of the NVH 0391/98 strain.
Adware/Popup Window Blocking Tool, supplied by AdWare Research Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prism+statistical+software+package+for+windows%2C+version+6%2E0/10__55041_slash_ijsrem32242-292-52-56?v=AdWare+Research+Ltd
Average 90 stars, based on 1 article reviews
adware/popup window blocking tool - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


Expression profiles of inhA1, nprA, and hlyII among B. cereus strains. Logarithmic representation of the expression levels of inhA1, nprA, and hlyII among 57 (54 for inhA1) B. cereus nonpathogenic (NP), food-poisoning (FP), and clinical (C) strains normalized to the mean expression value of the two reference genes rpoA and rpoB. For each strain, the mean value of two independent experiments done in duplicate is represented as a cross. For each pathogenic profile, the mean value is represented as a dot and the median value as a bold line. The × symbol represents the nprA expression level of the NVH 0391/98 strain.

Journal: Journal of Clinical Microbiology

Article Title: InhA1, NprA, and HlyII as Candidates for Markers To Differentiate Pathogenic from Nonpathogenic Bacillus cereus Strains ▿

doi: 10.1128/JCM.02123-09

Figure Lengend Snippet: Expression profiles of inhA1, nprA, and hlyII among B. cereus strains. Logarithmic representation of the expression levels of inhA1, nprA, and hlyII among 57 (54 for inhA1) B. cereus nonpathogenic (NP), food-poisoning (FP), and clinical (C) strains normalized to the mean expression value of the two reference genes rpoA and rpoB. For each strain, the mean value of two independent experiments done in duplicate is represented as a cross. For each pathogenic profile, the mean value is represented as a dot and the median value as a bold line. The × symbol represents the nprA expression level of the NVH 0391/98 strain.

Article Snippet: In some strains, if the targeted gene had not been detected with the first primer pair, a second screen was performed with another primer pair (Table ). table ft1 table-wrap mode="anchored" t5 TABLE 2. caption a7 Primer purpose and target gene (locus tag a ) Primer b Primer sequence c (5′-3′) Location within gene a Annealing temp (°C) Product size (bp) Reference or source PCR for inhA1 , nprA , and hlyII detection inhA1 (BC1284) F-inhA1-d1 ACGCITTIAAATTTGCICG 1937-1955 55 257 This study R-inhA1-d1 ACGCGTTGGAGATACAACTT 2193-2174 F-inhA1-d2 CCAGCTTGGAAAGTTGTATC 2164-2183 55 166 This study R-inhA1-d2 CAGCTTGTCCTACTACTTCA 2329-2310 nprA (BC0602) F-nprA-d GTATACGGAGATGGTGATGG 1111-1130 55 263 This study R-nprA-d GGATCACTCATAGAGCGAAG 1373-1354 hlyII (BC3523) Fhly-II GATTCTAAAGGAACTGTAG 94-112 48 868 19 Rhly-II GGTTATCAAGAGTAACTTG 961-943 F-hlyII-d CAAGTTACTCTTGATAACC 943-961 48 194 This study R-hlyII-dq TCACCATTTACAAAGATACC 1136-1117 PCR amplification of hlyII probe hlyII (BC3523) F-hlyII-p GCATTTGCAGATTCTAAAGG 85-104 55 1,019 This study R-hlyII-p TCGTAACTGATACCATAACC 1103-1084 RT-qPCR inhA1 (BC1284) F-inhA1-q GATAAAAC(A/G)CCAGCTTGGAAAG 2155-2176 60 189 This study R-inhA1-q TGCAGA(A/T)TTATCATCAGCTTG 2343-2323 nprA (BC0602) F-nprA-q TGCAGCAGCAGTAGATGCTC 951-970 60 188 This study R-nprA-q ATGTTACACCATCACCATC 1138-1120 hlyII (BC3523) F-hlyII-q CTGGAAAAACCATCAAGTTACTC 930-952 60 207 This study R-hlyII-dq TCACCATTTACAAAGATACC 1136-1117 rpoA (BC0158) F-rpoA-q TAACTCCTTACGTCGTATTC 111-130 60 186 This study R-rpoA-q ATTTCCAACGTCTTCTCTTC 296-277 rpoB (BC0122) F-rpoB-q TCAGTGGTTTCTTGATGAGG 111-130 60 176 This study R-rpoB-q CTTTTACACGAAGTGGTGCT 286-267 Open in a separate window a Reference strain Bacillus cereus ATCC 14579 (NCBI accession no. {"type":"entrez-nucleotide","attrs":{"text":"NC_004722","term_id":"30018278","term_text":"NC_004722"}} NC_004722 ). b F, forward primer; R, reverse primer. c I, inosine.

Techniques: Expressing